ID: 1146906170

View in Genome Browser
Species Human (GRCh38)
Location 17:36619407-36619429
Sequence TTCCAAAGTGCTAGGATTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 745651
Summary {0: 949, 1: 32879, 2: 322946, 3: 253370, 4: 135507}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146906170_1146906175 -8 Left 1146906170 17:36619407-36619429 CCTGTAATCCTAGCACTTTGGAA 0: 949
1: 32879
2: 322946
3: 253370
4: 135507
Right 1146906175 17:36619422-36619444 CTTTGGAAGGCCAAGGTGGATGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
1146906170_1146906178 8 Left 1146906170 17:36619407-36619429 CCTGTAATCCTAGCACTTTGGAA 0: 949
1: 32879
2: 322946
3: 253370
4: 135507
Right 1146906178 17:36619438-36619460 TGGATGGATAACTTGAGGTCAGG 0: 5
1: 485
2: 9270
3: 40639
4: 85218
1146906170_1146906177 3 Left 1146906170 17:36619407-36619429 CCTGTAATCCTAGCACTTTGGAA 0: 949
1: 32879
2: 322946
3: 253370
4: 135507
Right 1146906177 17:36619433-36619455 CAAGGTGGATGGATAACTTGAGG No data
1146906170_1146906180 10 Left 1146906170 17:36619407-36619429 CCTGTAATCCTAGCACTTTGGAA 0: 949
1: 32879
2: 322946
3: 253370
4: 135507
Right 1146906180 17:36619440-36619462 GATGGATAACTTGAGGTCAGGGG No data
1146906170_1146906179 9 Left 1146906170 17:36619407-36619429 CCTGTAATCCTAGCACTTTGGAA 0: 949
1: 32879
2: 322946
3: 253370
4: 135507
Right 1146906179 17:36619439-36619461 GGATGGATAACTTGAGGTCAGGG No data
1146906170_1146906181 26 Left 1146906170 17:36619407-36619429 CCTGTAATCCTAGCACTTTGGAA 0: 949
1: 32879
2: 322946
3: 253370
4: 135507
Right 1146906181 17:36619456-36619478 TCAGGGGTTCAAGACCAGCCTGG 0: 1057
1: 53779
2: 124571
3: 172287
4: 193668

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146906170 Original CRISPR TTCCAAAGTGCTAGGATTAC AGG (reversed) Intergenic
Too many off-targets to display for this crispr