ID: 1146906175

View in Genome Browser
Species Human (GRCh38)
Location 17:36619422-36619444
Sequence CTTTGGAAGGCCAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274879
Summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146906168_1146906175 11 Left 1146906168 17:36619388-36619410 CCAGGTGCAGTGGCTCATGCCTG 0: 6440
1: 26478
2: 70922
3: 127775
4: 147131
Right 1146906175 17:36619422-36619444 CTTTGGAAGGCCAAGGTGGATGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
1146906165_1146906175 22 Left 1146906165 17:36619377-36619399 CCTGCCTTGGGCCAGGTGCAGTG No data
Right 1146906175 17:36619422-36619444 CTTTGGAAGGCCAAGGTGGATGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
1146906167_1146906175 18 Left 1146906167 17:36619381-36619403 CCTTGGGCCAGGTGCAGTGGCTC 0: 32
1: 223
2: 895
3: 2118
4: 3996
Right 1146906175 17:36619422-36619444 CTTTGGAAGGCCAAGGTGGATGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
1146906164_1146906175 23 Left 1146906164 17:36619376-36619398 CCCTGCCTTGGGCCAGGTGCAGT No data
Right 1146906175 17:36619422-36619444 CTTTGGAAGGCCAAGGTGGATGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
1146906170_1146906175 -8 Left 1146906170 17:36619407-36619429 CCTGTAATCCTAGCACTTTGGAA 0: 949
1: 32879
2: 322946
3: 253370
4: 135507
Right 1146906175 17:36619422-36619444 CTTTGGAAGGCCAAGGTGGATGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146906175 Original CRISPR CTTTGGAAGGCCAAGGTGGA TGG Intergenic
Too many off-targets to display for this crispr