ID: 1146907884

View in Genome Browser
Species Human (GRCh38)
Location 17:36629690-36629712
Sequence CAGAGGGACCAGAGGGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146907873_1146907884 23 Left 1146907873 17:36629644-36629666 CCTGGTCATTCTTGGGTCGGGGC No data
Right 1146907884 17:36629690-36629712 CAGAGGGACCAGAGGGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146907884 Original CRISPR CAGAGGGACCAGAGGGCAGC TGG Intergenic
No off target data available for this crispr