ID: 1146908483

View in Genome Browser
Species Human (GRCh38)
Location 17:36632947-36632969
Sequence CCGCACTTACCCTTTGCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146908483_1146908487 -9 Left 1146908483 17:36632947-36632969 CCTAGAGCAAAGGGTAAGTGCGG No data
Right 1146908487 17:36632961-36632983 TAAGTGCGGTAAAACGGAAAGGG No data
1146908483_1146908488 10 Left 1146908483 17:36632947-36632969 CCTAGAGCAAAGGGTAAGTGCGG No data
Right 1146908488 17:36632980-36633002 AGGGCGTTGTTCCCAATTCCTGG No data
1146908483_1146908492 29 Left 1146908483 17:36632947-36632969 CCTAGAGCAAAGGGTAAGTGCGG No data
Right 1146908492 17:36632999-36633021 CTGGATTATTAAAACAAAAGCGG No data
1146908483_1146908486 -10 Left 1146908483 17:36632947-36632969 CCTAGAGCAAAGGGTAAGTGCGG No data
Right 1146908486 17:36632960-36632982 GTAAGTGCGGTAAAACGGAAAGG No data
1146908483_1146908493 30 Left 1146908483 17:36632947-36632969 CCTAGAGCAAAGGGTAAGTGCGG No data
Right 1146908493 17:36633000-36633022 TGGATTATTAAAACAAAAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146908483 Original CRISPR CCGCACTTACCCTTTGCTCT AGG (reversed) Intergenic
No off target data available for this crispr