ID: 1146909957

View in Genome Browser
Species Human (GRCh38)
Location 17:36642022-36642044
Sequence GGCGCTGCCGGCCTCGAGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146909947_1146909957 8 Left 1146909947 17:36641991-36642013 CCACAATGGGTGTGCATGGCGCG No data
Right 1146909957 17:36642022-36642044 GGCGCTGCCGGCCTCGAGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146909957 Original CRISPR GGCGCTGCCGGCCTCGAGCG AGG Intergenic
No off target data available for this crispr