ID: 1146911000

View in Genome Browser
Species Human (GRCh38)
Location 17:36648469-36648491
Sequence CTCCAATTGAAGTCAGCCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146910994_1146911000 23 Left 1146910994 17:36648423-36648445 CCCAGCCACAAACTGATTTTATA No data
Right 1146911000 17:36648469-36648491 CTCCAATTGAAGTCAGCCTATGG No data
1146910996_1146911000 18 Left 1146910996 17:36648428-36648450 CCACAAACTGATTTTATATTTGT No data
Right 1146911000 17:36648469-36648491 CTCCAATTGAAGTCAGCCTATGG No data
1146910995_1146911000 22 Left 1146910995 17:36648424-36648446 CCAGCCACAAACTGATTTTATAT No data
Right 1146911000 17:36648469-36648491 CTCCAATTGAAGTCAGCCTATGG No data
1146910993_1146911000 28 Left 1146910993 17:36648418-36648440 CCGAGCCCAGCCACAAACTGATT No data
Right 1146911000 17:36648469-36648491 CTCCAATTGAAGTCAGCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146911000 Original CRISPR CTCCAATTGAAGTCAGCCTA TGG Intergenic
No off target data available for this crispr