ID: 1146913709

View in Genome Browser
Species Human (GRCh38)
Location 17:36664807-36664829
Sequence ATGGAGAAACTGAGTCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146913704_1146913709 -10 Left 1146913704 17:36664794-36664816 CCCCATTGTACAGATGGAGAAAC No data
Right 1146913709 17:36664807-36664829 ATGGAGAAACTGAGTCTGGGAGG No data
1146913699_1146913709 15 Left 1146913699 17:36664769-36664791 CCTTTGAGTCAGGAACCGCCACT No data
Right 1146913709 17:36664807-36664829 ATGGAGAAACTGAGTCTGGGAGG No data
1146913701_1146913709 -3 Left 1146913701 17:36664787-36664809 CCACTGCCCCCATTGTACAGATG No data
Right 1146913709 17:36664807-36664829 ATGGAGAAACTGAGTCTGGGAGG No data
1146913698_1146913709 16 Left 1146913698 17:36664768-36664790 CCCTTTGAGTCAGGAACCGCCAC No data
Right 1146913709 17:36664807-36664829 ATGGAGAAACTGAGTCTGGGAGG No data
1146913700_1146913709 0 Left 1146913700 17:36664784-36664806 CCGCCACTGCCCCCATTGTACAG No data
Right 1146913709 17:36664807-36664829 ATGGAGAAACTGAGTCTGGGAGG No data
1146913703_1146913709 -9 Left 1146913703 17:36664793-36664815 CCCCCATTGTACAGATGGAGAAA No data
Right 1146913709 17:36664807-36664829 ATGGAGAAACTGAGTCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146913709 Original CRISPR ATGGAGAAACTGAGTCTGGG AGG Intergenic
No off target data available for this crispr