ID: 1146916143

View in Genome Browser
Species Human (GRCh38)
Location 17:36679683-36679705
Sequence AGCCCCTTGATGAAAGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146916143_1146916153 21 Left 1146916143 17:36679683-36679705 CCTTTCCCTTTCATCAAGGGGCT No data
Right 1146916153 17:36679727-36679749 CTGACATGGCCCCCTGGGCCTGG No data
1146916143_1146916147 7 Left 1146916143 17:36679683-36679705 CCTTTCCCTTTCATCAAGGGGCT No data
Right 1146916147 17:36679713-36679735 CTGAGACCAAGTCCCTGACATGG No data
1146916143_1146916149 15 Left 1146916143 17:36679683-36679705 CCTTTCCCTTTCATCAAGGGGCT No data
Right 1146916149 17:36679721-36679743 AAGTCCCTGACATGGCCCCCTGG No data
1146916143_1146916154 25 Left 1146916143 17:36679683-36679705 CCTTTCCCTTTCATCAAGGGGCT No data
Right 1146916154 17:36679731-36679753 CATGGCCCCCTGGGCCTGGCTGG No data
1146916143_1146916150 16 Left 1146916143 17:36679683-36679705 CCTTTCCCTTTCATCAAGGGGCT No data
Right 1146916150 17:36679722-36679744 AGTCCCTGACATGGCCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146916143 Original CRISPR AGCCCCTTGATGAAAGGGAA AGG (reversed) Intergenic
No off target data available for this crispr