ID: 1146916572

View in Genome Browser
Species Human (GRCh38)
Location 17:36681935-36681957
Sequence GACATACTGGTGGCCCCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146916566_1146916572 3 Left 1146916566 17:36681909-36681931 CCACTGATAGATGGTGGGTGGGG No data
Right 1146916572 17:36681935-36681957 GACATACTGGTGGCCCCAGTTGG No data
1146916564_1146916572 4 Left 1146916564 17:36681908-36681930 CCCACTGATAGATGGTGGGTGGG No data
Right 1146916572 17:36681935-36681957 GACATACTGGTGGCCCCAGTTGG No data
1146916559_1146916572 12 Left 1146916559 17:36681900-36681922 CCGAGAAACCCACTGATAGATGG No data
Right 1146916572 17:36681935-36681957 GACATACTGGTGGCCCCAGTTGG No data
1146916557_1146916572 30 Left 1146916557 17:36681882-36681904 CCAGACACCACGTGGAGGCCGAG No data
Right 1146916572 17:36681935-36681957 GACATACTGGTGGCCCCAGTTGG No data
1146916558_1146916572 23 Left 1146916558 17:36681889-36681911 CCACGTGGAGGCCGAGAAACCCA No data
Right 1146916572 17:36681935-36681957 GACATACTGGTGGCCCCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146916572 Original CRISPR GACATACTGGTGGCCCCAGT TGG Intergenic