ID: 1146916856

View in Genome Browser
Species Human (GRCh38)
Location 17:36683481-36683503
Sequence CAGATTACAGAGCAGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146916856_1146916866 15 Left 1146916856 17:36683481-36683503 CCAGCCTCCTGCTCTGTAATCTG No data
Right 1146916866 17:36683519-36683541 CCTCTTCCAGCGAAGGCCCCGGG No data
1146916856_1146916860 8 Left 1146916856 17:36683481-36683503 CCAGCCTCCTGCTCTGTAATCTG No data
Right 1146916860 17:36683512-36683534 TTCCCCACCTCTTCCAGCGAAGG No data
1146916856_1146916864 14 Left 1146916856 17:36683481-36683503 CCAGCCTCCTGCTCTGTAATCTG No data
Right 1146916864 17:36683518-36683540 ACCTCTTCCAGCGAAGGCCCCGG No data
1146916856_1146916867 16 Left 1146916856 17:36683481-36683503 CCAGCCTCCTGCTCTGTAATCTG No data
Right 1146916867 17:36683520-36683542 CTCTTCCAGCGAAGGCCCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146916856 Original CRISPR CAGATTACAGAGCAGGAGGC TGG (reversed) Intergenic
No off target data available for this crispr