ID: 1146917247

View in Genome Browser
Species Human (GRCh38)
Location 17:36686142-36686164
Sequence ATGGTCACACAGCTGCGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146917247_1146917255 16 Left 1146917247 17:36686142-36686164 CCCTTTCGCAGCTGTGTGACCAT No data
Right 1146917255 17:36686181-36686203 GTTTCTGAGCAGAGTTTCTGAGG No data
1146917247_1146917256 17 Left 1146917247 17:36686142-36686164 CCCTTTCGCAGCTGTGTGACCAT No data
Right 1146917256 17:36686182-36686204 TTTCTGAGCAGAGTTTCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146917247 Original CRISPR ATGGTCACACAGCTGCGAAA GGG (reversed) Intergenic
No off target data available for this crispr