ID: 1146919244

View in Genome Browser
Species Human (GRCh38)
Location 17:36698875-36698897
Sequence GAGAATCCCTGCGGCCTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146919244_1146919247 6 Left 1146919244 17:36698875-36698897 CCCAAGAGGCCGCAGGGATTCTC No data
Right 1146919247 17:36698904-36698926 GAGTTCTGTCCACAGATATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146919244 Original CRISPR GAGAATCCCTGCGGCCTCTT GGG (reversed) Intergenic
No off target data available for this crispr