ID: 1146922759

View in Genome Browser
Species Human (GRCh38)
Location 17:36724384-36724406
Sequence AGGTGTTTCCTGGGCATTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146922753_1146922759 17 Left 1146922753 17:36724344-36724366 CCTGCTGGTCTCAGAGTATAATG No data
Right 1146922759 17:36724384-36724406 AGGTGTTTCCTGGGCATTCGTGG No data
1146922752_1146922759 24 Left 1146922752 17:36724337-36724359 CCTCATGCCTGCTGGTCTCAGAG No data
Right 1146922759 17:36724384-36724406 AGGTGTTTCCTGGGCATTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146922759 Original CRISPR AGGTGTTTCCTGGGCATTCG TGG Intergenic
No off target data available for this crispr