ID: 1146925100

View in Genome Browser
Species Human (GRCh38)
Location 17:36739099-36739121
Sequence TACCCCCAGCTCCCTGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146925100_1146925108 -7 Left 1146925100 17:36739099-36739121 CCAGAAACAGGGAGCTGGGGGTA No data
Right 1146925108 17:36739115-36739137 GGGGGTAGGGAGGGTGGGATGGG No data
1146925100_1146925107 -8 Left 1146925100 17:36739099-36739121 CCAGAAACAGGGAGCTGGGGGTA No data
Right 1146925107 17:36739114-36739136 TGGGGGTAGGGAGGGTGGGATGG No data
1146925100_1146925109 -6 Left 1146925100 17:36739099-36739121 CCAGAAACAGGGAGCTGGGGGTA No data
Right 1146925109 17:36739116-36739138 GGGGTAGGGAGGGTGGGATGGGG No data
1146925100_1146925110 24 Left 1146925100 17:36739099-36739121 CCAGAAACAGGGAGCTGGGGGTA No data
Right 1146925110 17:36739146-36739168 AGTCAACAGATACAAAGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146925100 Original CRISPR TACCCCCAGCTCCCTGTTTC TGG (reversed) Intergenic
No off target data available for this crispr