ID: 1146926163

View in Genome Browser
Species Human (GRCh38)
Location 17:36747269-36747291
Sequence CATGCACACGTGAGTCCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146926163_1146926164 2 Left 1146926163 17:36747269-36747291 CCACATGGACTCACGTGTGCATG No data
Right 1146926164 17:36747294-36747316 CAACACACACATACACACACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146926163 Original CRISPR CATGCACACGTGAGTCCATG TGG (reversed) Intergenic