ID: 1146926164 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:36747294-36747316 |
Sequence | CAACACACACATACACACAC CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1146926163_1146926164 | 2 | Left | 1146926163 | 17:36747269-36747291 | CCACATGGACTCACGTGTGCATG | No data | ||
Right | 1146926164 | 17:36747294-36747316 | CAACACACACATACACACACCGG | No data | ||||
1146926162_1146926164 | 9 | Left | 1146926162 | 17:36747262-36747284 | CCTCACACCACATGGACTCACGT | No data | ||
Right | 1146926164 | 17:36747294-36747316 | CAACACACACATACACACACCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1146926164 | Original CRISPR | CAACACACACATACACACAC CGG | Intergenic | ||