ID: 1146928154

View in Genome Browser
Species Human (GRCh38)
Location 17:36759116-36759138
Sequence GGGTGCTAATCTATTCATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146928154_1146928158 -4 Left 1146928154 17:36759116-36759138 CCCTCATGAATAGATTAGCACCC No data
Right 1146928158 17:36759135-36759157 ACCCTTATAAAAGGGCTTGAAGG No data
1146928154_1146928161 7 Left 1146928154 17:36759116-36759138 CCCTCATGAATAGATTAGCACCC No data
Right 1146928161 17:36759146-36759168 AGGGCTTGAAGGAACTAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146928154 Original CRISPR GGGTGCTAATCTATTCATGA GGG (reversed) Intergenic
No off target data available for this crispr