ID: 1146929254

View in Genome Browser
Species Human (GRCh38)
Location 17:36766139-36766161
Sequence GGTAATAACCGGTCTGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146929245_1146929254 22 Left 1146929245 17:36766094-36766116 CCTCAGGGATTAGCTAGTCTGAT No data
Right 1146929254 17:36766139-36766161 GGTAATAACCGGTCTGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146929254 Original CRISPR GGTAATAACCGGTCTGATGA AGG Intergenic
No off target data available for this crispr