ID: 1146929837

View in Genome Browser
Species Human (GRCh38)
Location 17:36769131-36769153
Sequence CCTTATGGCCAGAGGGAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146929832_1146929837 -9 Left 1146929832 17:36769117-36769139 CCTCCTTGCTGATTCCTTATGGC No data
Right 1146929837 17:36769131-36769153 CCTTATGGCCAGAGGGAATCTGG No data
1146929829_1146929837 7 Left 1146929829 17:36769101-36769123 CCCTGGGGATGGTGAGCCTCCTT No data
Right 1146929837 17:36769131-36769153 CCTTATGGCCAGAGGGAATCTGG No data
1146929828_1146929837 10 Left 1146929828 17:36769098-36769120 CCTCCCTGGGGATGGTGAGCCTC No data
Right 1146929837 17:36769131-36769153 CCTTATGGCCAGAGGGAATCTGG No data
1146929830_1146929837 6 Left 1146929830 17:36769102-36769124 CCTGGGGATGGTGAGCCTCCTTG No data
Right 1146929837 17:36769131-36769153 CCTTATGGCCAGAGGGAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146929837 Original CRISPR CCTTATGGCCAGAGGGAATC TGG Intergenic
No off target data available for this crispr