ID: 1146931145

View in Genome Browser
Species Human (GRCh38)
Location 17:36778805-36778827
Sequence CTGTGCTGGAGGAGGGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146931145_1146931153 8 Left 1146931145 17:36778805-36778827 CCAGCTGCCCTCCTCCAGCACAG No data
Right 1146931153 17:36778836-36778858 CACAGAAGCCTGAACTGACAAGG No data
1146931145_1146931154 15 Left 1146931145 17:36778805-36778827 CCAGCTGCCCTCCTCCAGCACAG No data
Right 1146931154 17:36778843-36778865 GCCTGAACTGACAAGGAACCTGG No data
1146931145_1146931156 22 Left 1146931145 17:36778805-36778827 CCAGCTGCCCTCCTCCAGCACAG No data
Right 1146931156 17:36778850-36778872 CTGACAAGGAACCTGGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146931145 Original CRISPR CTGTGCTGGAGGAGGGCAGC TGG (reversed) Intergenic
No off target data available for this crispr