ID: 1146931601

View in Genome Browser
Species Human (GRCh38)
Location 17:36782093-36782115
Sequence CTTTGGACACAGATGGGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146931586_1146931601 28 Left 1146931586 17:36782042-36782064 CCCATTTTTCATCTGAAGAATCT No data
Right 1146931601 17:36782093-36782115 CTTTGGACACAGATGGGAAATGG No data
1146931594_1146931601 1 Left 1146931594 17:36782069-36782091 CCCAGGGAGGTTTGCGTGGTGGG No data
Right 1146931601 17:36782093-36782115 CTTTGGACACAGATGGGAAATGG No data
1146931587_1146931601 27 Left 1146931587 17:36782043-36782065 CCATTTTTCATCTGAAGAATCTG No data
Right 1146931601 17:36782093-36782115 CTTTGGACACAGATGGGAAATGG No data
1146931596_1146931601 0 Left 1146931596 17:36782070-36782092 CCAGGGAGGTTTGCGTGGTGGGC No data
Right 1146931601 17:36782093-36782115 CTTTGGACACAGATGGGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146931601 Original CRISPR CTTTGGACACAGATGGGAAA TGG Intergenic
No off target data available for this crispr