ID: 1146931833

View in Genome Browser
Species Human (GRCh38)
Location 17:36783169-36783191
Sequence CCGGACCCTGCACTGGCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146931817_1146931833 25 Left 1146931817 17:36783121-36783143 CCATCCCCAGAGGGTGCCATTTA No data
Right 1146931833 17:36783169-36783191 CCGGACCCTGCACTGGCTTGGGG No data
1146931824_1146931833 -2 Left 1146931824 17:36783148-36783170 CCGCTGCAGGTGCCATGAGCCCC No data
Right 1146931833 17:36783169-36783191 CCGGACCCTGCACTGGCTTGGGG No data
1146931823_1146931833 -1 Left 1146931823 17:36783147-36783169 CCCGCTGCAGGTGCCATGAGCCC No data
Right 1146931833 17:36783169-36783191 CCGGACCCTGCACTGGCTTGGGG No data
1146931819_1146931833 20 Left 1146931819 17:36783126-36783148 CCCAGAGGGTGCCATTTAACTCC No data
Right 1146931833 17:36783169-36783191 CCGGACCCTGCACTGGCTTGGGG No data
1146931816_1146931833 26 Left 1146931816 17:36783120-36783142 CCCATCCCCAGAGGGTGCCATTT No data
Right 1146931833 17:36783169-36783191 CCGGACCCTGCACTGGCTTGGGG No data
1146931820_1146931833 19 Left 1146931820 17:36783127-36783149 CCAGAGGGTGCCATTTAACTCCC No data
Right 1146931833 17:36783169-36783191 CCGGACCCTGCACTGGCTTGGGG No data
1146931822_1146931833 9 Left 1146931822 17:36783137-36783159 CCATTTAACTCCCGCTGCAGGTG No data
Right 1146931833 17:36783169-36783191 CCGGACCCTGCACTGGCTTGGGG No data
1146931818_1146931833 21 Left 1146931818 17:36783125-36783147 CCCCAGAGGGTGCCATTTAACTC No data
Right 1146931833 17:36783169-36783191 CCGGACCCTGCACTGGCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146931833 Original CRISPR CCGGACCCTGCACTGGCTTG GGG Intergenic
No off target data available for this crispr