ID: 1146934479

View in Genome Browser
Species Human (GRCh38)
Location 17:36804031-36804053
Sequence TCTCACTAGGTGCCCTGTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146934479_1146934483 -9 Left 1146934479 17:36804031-36804053 CCTATACAGGGCACCTAGTGAGA No data
Right 1146934483 17:36804045-36804067 CTAGTGAGAGGGCCCCAGAGAGG No data
1146934479_1146934484 2 Left 1146934479 17:36804031-36804053 CCTATACAGGGCACCTAGTGAGA No data
Right 1146934484 17:36804056-36804078 GCCCCAGAGAGGTCCTTATATGG No data
1146934479_1146934488 7 Left 1146934479 17:36804031-36804053 CCTATACAGGGCACCTAGTGAGA No data
Right 1146934488 17:36804061-36804083 AGAGAGGTCCTTATATGGTGTGG No data
1146934479_1146934492 25 Left 1146934479 17:36804031-36804053 CCTATACAGGGCACCTAGTGAGA No data
Right 1146934492 17:36804079-36804101 TGTGGCTGGAAGACACCATTGGG No data
1146934479_1146934489 11 Left 1146934479 17:36804031-36804053 CCTATACAGGGCACCTAGTGAGA No data
Right 1146934489 17:36804065-36804087 AGGTCCTTATATGGTGTGGCTGG No data
1146934479_1146934491 24 Left 1146934479 17:36804031-36804053 CCTATACAGGGCACCTAGTGAGA No data
Right 1146934491 17:36804078-36804100 GTGTGGCTGGAAGACACCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146934479 Original CRISPR TCTCACTAGGTGCCCTGTAT AGG (reversed) Intergenic
No off target data available for this crispr