ID: 1146934482

View in Genome Browser
Species Human (GRCh38)
Location 17:36804044-36804066
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146934482_1146934491 11 Left 1146934482 17:36804044-36804066 CCTAGTGAGAGGGCCCCAGAGAG No data
Right 1146934491 17:36804078-36804100 GTGTGGCTGGAAGACACCATTGG No data
1146934482_1146934488 -6 Left 1146934482 17:36804044-36804066 CCTAGTGAGAGGGCCCCAGAGAG No data
Right 1146934488 17:36804061-36804083 AGAGAGGTCCTTATATGGTGTGG No data
1146934482_1146934489 -2 Left 1146934482 17:36804044-36804066 CCTAGTGAGAGGGCCCCAGAGAG No data
Right 1146934489 17:36804065-36804087 AGGTCCTTATATGGTGTGGCTGG No data
1146934482_1146934492 12 Left 1146934482 17:36804044-36804066 CCTAGTGAGAGGGCCCCAGAGAG No data
Right 1146934492 17:36804079-36804101 TGTGGCTGGAAGACACCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146934482 Original CRISPR CTCTCTGGGGCCCTCTCACT AGG (reversed) Intergenic