ID: 1146934484

View in Genome Browser
Species Human (GRCh38)
Location 17:36804056-36804078
Sequence GCCCCAGAGAGGTCCTTATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146934479_1146934484 2 Left 1146934479 17:36804031-36804053 CCTATACAGGGCACCTAGTGAGA No data
Right 1146934484 17:36804056-36804078 GCCCCAGAGAGGTCCTTATATGG No data
1146934476_1146934484 18 Left 1146934476 17:36804015-36804037 CCAAGCACAAGGAATTCCTATAC No data
Right 1146934484 17:36804056-36804078 GCCCCAGAGAGGTCCTTATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146934484 Original CRISPR GCCCCAGAGAGGTCCTTATA TGG Intergenic
No off target data available for this crispr