ID: 1146934486

View in Genome Browser
Species Human (GRCh38)
Location 17:36804058-36804080
Sequence CACCATATAAGGACCTCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146934486_1146934496 25 Left 1146934486 17:36804058-36804080 CCCAGAGAGGTCCTTATATGGTG No data
Right 1146934496 17:36804106-36804128 ATTAATTTAGACTCAGCCAGGGG No data
1146934486_1146934491 -3 Left 1146934486 17:36804058-36804080 CCCAGAGAGGTCCTTATATGGTG No data
Right 1146934491 17:36804078-36804100 GTGTGGCTGGAAGACACCATTGG No data
1146934486_1146934492 -2 Left 1146934486 17:36804058-36804080 CCCAGAGAGGTCCTTATATGGTG No data
Right 1146934492 17:36804079-36804101 TGTGGCTGGAAGACACCATTGGG No data
1146934486_1146934495 24 Left 1146934486 17:36804058-36804080 CCCAGAGAGGTCCTTATATGGTG No data
Right 1146934495 17:36804105-36804127 AATTAATTTAGACTCAGCCAGGG No data
1146934486_1146934494 23 Left 1146934486 17:36804058-36804080 CCCAGAGAGGTCCTTATATGGTG No data
Right 1146934494 17:36804104-36804126 AAATTAATTTAGACTCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146934486 Original CRISPR CACCATATAAGGACCTCTCT GGG (reversed) Intergenic