ID: 1146934489

View in Genome Browser
Species Human (GRCh38)
Location 17:36804065-36804087
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146934482_1146934489 -2 Left 1146934482 17:36804044-36804066 CCTAGTGAGAGGGCCCCAGAGAG No data
Right 1146934489 17:36804065-36804087 AGGTCCTTATATGGTGTGGCTGG No data
1146934476_1146934489 27 Left 1146934476 17:36804015-36804037 CCAAGCACAAGGAATTCCTATAC No data
Right 1146934489 17:36804065-36804087 AGGTCCTTATATGGTGTGGCTGG No data
1146934479_1146934489 11 Left 1146934479 17:36804031-36804053 CCTATACAGGGCACCTAGTGAGA No data
Right 1146934489 17:36804065-36804087 AGGTCCTTATATGGTGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146934489 Original CRISPR AGGTCCTTATATGGTGTGGC TGG Intergenic
No off target data available for this crispr