ID: 1146934492

View in Genome Browser
Species Human (GRCh38)
Location 17:36804079-36804101
Sequence TGTGGCTGGAAGACACCATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146934486_1146934492 -2 Left 1146934486 17:36804058-36804080 CCCAGAGAGGTCCTTATATGGTG No data
Right 1146934492 17:36804079-36804101 TGTGGCTGGAAGACACCATTGGG No data
1146934487_1146934492 -3 Left 1146934487 17:36804059-36804081 CCAGAGAGGTCCTTATATGGTGT No data
Right 1146934492 17:36804079-36804101 TGTGGCTGGAAGACACCATTGGG No data
1146934482_1146934492 12 Left 1146934482 17:36804044-36804066 CCTAGTGAGAGGGCCCCAGAGAG No data
Right 1146934492 17:36804079-36804101 TGTGGCTGGAAGACACCATTGGG No data
1146934485_1146934492 -1 Left 1146934485 17:36804057-36804079 CCCCAGAGAGGTCCTTATATGGT No data
Right 1146934492 17:36804079-36804101 TGTGGCTGGAAGACACCATTGGG No data
1146934479_1146934492 25 Left 1146934479 17:36804031-36804053 CCTATACAGGGCACCTAGTGAGA No data
Right 1146934492 17:36804079-36804101 TGTGGCTGGAAGACACCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146934492 Original CRISPR TGTGGCTGGAAGACACCATT GGG Intergenic
No off target data available for this crispr