ID: 1146934495

View in Genome Browser
Species Human (GRCh38)
Location 17:36804105-36804127
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146934487_1146934495 23 Left 1146934487 17:36804059-36804081 CCAGAGAGGTCCTTATATGGTGT No data
Right 1146934495 17:36804105-36804127 AATTAATTTAGACTCAGCCAGGG No data
1146934485_1146934495 25 Left 1146934485 17:36804057-36804079 CCCCAGAGAGGTCCTTATATGGT No data
Right 1146934495 17:36804105-36804127 AATTAATTTAGACTCAGCCAGGG No data
1146934490_1146934495 13 Left 1146934490 17:36804069-36804091 CCTTATATGGTGTGGCTGGAAGA No data
Right 1146934495 17:36804105-36804127 AATTAATTTAGACTCAGCCAGGG No data
1146934486_1146934495 24 Left 1146934486 17:36804058-36804080 CCCAGAGAGGTCCTTATATGGTG No data
Right 1146934495 17:36804105-36804127 AATTAATTTAGACTCAGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146934495 Original CRISPR AATTAATTTAGACTCAGCCA GGG Intergenic