ID: 1146935391

View in Genome Browser
Species Human (GRCh38)
Location 17:36809756-36809778
Sequence CATCCTGTTACCAGTTTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146935391_1146935405 29 Left 1146935391 17:36809756-36809778 CCTGGAAAACTGGTAACAGGATG No data
Right 1146935405 17:36809808-36809830 CCCCCCAGCCCCAGAGCACAGGG No data
1146935391_1146935398 0 Left 1146935391 17:36809756-36809778 CCTGGAAAACTGGTAACAGGATG No data
Right 1146935398 17:36809779-36809801 AGAAGAAAGGGGGCCCCTCGGGG No data
1146935391_1146935396 -2 Left 1146935391 17:36809756-36809778 CCTGGAAAACTGGTAACAGGATG No data
Right 1146935396 17:36809777-36809799 TGAGAAGAAAGGGGGCCCCTCGG No data
1146935391_1146935395 -10 Left 1146935391 17:36809756-36809778 CCTGGAAAACTGGTAACAGGATG No data
Right 1146935395 17:36809769-36809791 TAACAGGATGAGAAGAAAGGGGG No data
1146935391_1146935403 28 Left 1146935391 17:36809756-36809778 CCTGGAAAACTGGTAACAGGATG No data
Right 1146935403 17:36809807-36809829 CCCCCCCAGCCCCAGAGCACAGG No data
1146935391_1146935397 -1 Left 1146935391 17:36809756-36809778 CCTGGAAAACTGGTAACAGGATG No data
Right 1146935397 17:36809778-36809800 GAGAAGAAAGGGGGCCCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146935391 Original CRISPR CATCCTGTTACCAGTTTTCC AGG (reversed) Intergenic
No off target data available for this crispr