ID: 1146935762

View in Genome Browser
Species Human (GRCh38)
Location 17:36811719-36811741
Sequence CTGACATTTTCTCCCACACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146935762_1146935770 17 Left 1146935762 17:36811719-36811741 CCTAGTGTGGGAGAAAATGTCAG No data
Right 1146935770 17:36811759-36811781 CACCCATTGTCTGCATCTTGGGG No data
1146935762_1146935767 -6 Left 1146935762 17:36811719-36811741 CCTAGTGTGGGAGAAAATGTCAG No data
Right 1146935767 17:36811736-36811758 TGTCAGGCAAAGGAAAGGAAGGG No data
1146935762_1146935773 27 Left 1146935762 17:36811719-36811741 CCTAGTGTGGGAGAAAATGTCAG No data
Right 1146935773 17:36811769-36811791 CTGCATCTTGGGGAGAACACTGG No data
1146935762_1146935769 16 Left 1146935762 17:36811719-36811741 CCTAGTGTGGGAGAAAATGTCAG No data
Right 1146935769 17:36811758-36811780 GCACCCATTGTCTGCATCTTGGG No data
1146935762_1146935768 15 Left 1146935762 17:36811719-36811741 CCTAGTGTGGGAGAAAATGTCAG No data
Right 1146935768 17:36811757-36811779 GGCACCCATTGTCTGCATCTTGG No data
1146935762_1146935766 -7 Left 1146935762 17:36811719-36811741 CCTAGTGTGGGAGAAAATGTCAG No data
Right 1146935766 17:36811735-36811757 ATGTCAGGCAAAGGAAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146935762 Original CRISPR CTGACATTTTCTCCCACACT AGG (reversed) Intergenic