ID: 1146936099

View in Genome Browser
Species Human (GRCh38)
Location 17:36813530-36813552
Sequence TGGGAAGCTACAGCCTGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146936097_1146936099 -7 Left 1146936097 17:36813514-36813536 CCCTGGGGATGGGGGCTGGGAAG No data
Right 1146936099 17:36813530-36813552 TGGGAAGCTACAGCCTGAGAAGG No data
1146936082_1146936099 25 Left 1146936082 17:36813482-36813504 CCCCTCAAATAGGAGTCCTGGGA No data
Right 1146936099 17:36813530-36813552 TGGGAAGCTACAGCCTGAGAAGG No data
1146936095_1146936099 -5 Left 1146936095 17:36813512-36813534 CCCCCTGGGGATGGGGGCTGGGA No data
Right 1146936099 17:36813530-36813552 TGGGAAGCTACAGCCTGAGAAGG No data
1146936098_1146936099 -8 Left 1146936098 17:36813515-36813537 CCTGGGGATGGGGGCTGGGAAGC No data
Right 1146936099 17:36813530-36813552 TGGGAAGCTACAGCCTGAGAAGG No data
1146936086_1146936099 9 Left 1146936086 17:36813498-36813520 CCTGGGAACTGTCTCCCCCTGGG No data
Right 1146936099 17:36813530-36813552 TGGGAAGCTACAGCCTGAGAAGG No data
1146936084_1146936099 23 Left 1146936084 17:36813484-36813506 CCTCAAATAGGAGTCCTGGGAAC No data
Right 1146936099 17:36813530-36813552 TGGGAAGCTACAGCCTGAGAAGG No data
1146936096_1146936099 -6 Left 1146936096 17:36813513-36813535 CCCCTGGGGATGGGGGCTGGGAA No data
Right 1146936099 17:36813530-36813552 TGGGAAGCTACAGCCTGAGAAGG No data
1146936083_1146936099 24 Left 1146936083 17:36813483-36813505 CCCTCAAATAGGAGTCCTGGGAA No data
Right 1146936099 17:36813530-36813552 TGGGAAGCTACAGCCTGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146936099 Original CRISPR TGGGAAGCTACAGCCTGAGA AGG Intergenic
No off target data available for this crispr