ID: 1146937791

View in Genome Browser
Species Human (GRCh38)
Location 17:36823503-36823525
Sequence CCAGCCTGGCCCTACCCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146937781_1146937791 9 Left 1146937781 17:36823471-36823493 CCAGGGGATGGTGGCTGTCCGCC No data
Right 1146937791 17:36823503-36823525 CCAGCCTGGCCCTACCCTGGTGG No data
1146937775_1146937791 29 Left 1146937775 17:36823451-36823473 CCACTTGTTCGTTAGGGGTACCA No data
Right 1146937791 17:36823503-36823525 CCAGCCTGGCCCTACCCTGGTGG No data
1146937783_1146937791 -9 Left 1146937783 17:36823489-36823511 CCGCCCAGCCTGGCCCAGCCTGG No data
Right 1146937791 17:36823503-36823525 CCAGCCTGGCCCTACCCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146937791 Original CRISPR CCAGCCTGGCCCTACCCTGG TGG Intergenic
No off target data available for this crispr