ID: 1146938643

View in Genome Browser
Species Human (GRCh38)
Location 17:36828200-36828222
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146938633_1146938643 21 Left 1146938633 17:36828156-36828178 CCTATGGGATGATGTCAAAAGAG No data
Right 1146938643 17:36828200-36828222 GCATGGGAGGGCCACCTAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146938643 Original CRISPR GCATGGGAGGGCCACCTAAG GGG Intergenic
No off target data available for this crispr