ID: 1146939724

View in Genome Browser
Species Human (GRCh38)
Location 17:36836127-36836149
Sequence CCTCACACACACACTCCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146939724_1146939729 -6 Left 1146939724 17:36836127-36836149 CCCTGAGGAGTGTGTGTGTGAGG No data
Right 1146939729 17:36836144-36836166 GTGAGGTGGAGATTGGTAGATGG No data
1146939724_1146939730 -5 Left 1146939724 17:36836127-36836149 CCCTGAGGAGTGTGTGTGTGAGG No data
Right 1146939730 17:36836145-36836167 TGAGGTGGAGATTGGTAGATGGG No data
1146939724_1146939732 30 Left 1146939724 17:36836127-36836149 CCCTGAGGAGTGTGTGTGTGAGG No data
Right 1146939732 17:36836180-36836202 ATCAGCGAACTCAGCCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146939724 Original CRISPR CCTCACACACACACTCCTCA GGG (reversed) Intergenic
No off target data available for this crispr