ID: 1146939922

View in Genome Browser
Species Human (GRCh38)
Location 17:36837270-36837292
Sequence AAGGGGAGTTGAGCCTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146939922_1146939927 -6 Left 1146939922 17:36837270-36837292 CCTGCACAGGCTCAACTCCCCTT No data
Right 1146939927 17:36837287-36837309 CCCCTTGGCCATCAGGGCCCTGG No data
1146939922_1146939935 20 Left 1146939922 17:36837270-36837292 CCTGCACAGGCTCAACTCCCCTT No data
Right 1146939935 17:36837313-36837335 CAGGAGTGGCAGTCAAGACACGG No data
1146939922_1146939932 6 Left 1146939922 17:36837270-36837292 CCTGCACAGGCTCAACTCCCCTT No data
Right 1146939932 17:36837299-36837321 CAGGGCCCTGGCAGCAGGAGTGG No data
1146939922_1146939936 25 Left 1146939922 17:36837270-36837292 CCTGCACAGGCTCAACTCCCCTT No data
Right 1146939936 17:36837318-36837340 GTGGCAGTCAAGACACGGCCAGG No data
1146939922_1146939930 1 Left 1146939922 17:36837270-36837292 CCTGCACAGGCTCAACTCCCCTT No data
Right 1146939930 17:36837294-36837316 GCCATCAGGGCCCTGGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146939922 Original CRISPR AAGGGGAGTTGAGCCTGTGC AGG (reversed) Intergenic
No off target data available for this crispr