ID: 1146940224

View in Genome Browser
Species Human (GRCh38)
Location 17:36839335-36839357
Sequence CTCCTGAGGGGTCACAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146940224_1146940232 -7 Left 1146940224 17:36839335-36839357 CCCTCACTGTGACCCCTCAGGAG No data
Right 1146940232 17:36839351-36839373 TCAGGAGTGAGCCGGGCACAGGG No data
1146940224_1146940231 -8 Left 1146940224 17:36839335-36839357 CCCTCACTGTGACCCCTCAGGAG No data
Right 1146940231 17:36839350-36839372 CTCAGGAGTGAGCCGGGCACAGG No data
1146940224_1146940233 -6 Left 1146940224 17:36839335-36839357 CCCTCACTGTGACCCCTCAGGAG No data
Right 1146940233 17:36839352-36839374 CAGGAGTGAGCCGGGCACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146940224 Original CRISPR CTCCTGAGGGGTCACAGTGA GGG (reversed) Intergenic
No off target data available for this crispr