ID: 1146942215

View in Genome Browser
Species Human (GRCh38)
Location 17:36851176-36851198
Sequence CTGCGTCCAGGCTGTCTTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146942215_1146942218 -7 Left 1146942215 17:36851176-36851198 CCCGGAAGACAGCCTGGACGCAG No data
Right 1146942218 17:36851192-36851214 GACGCAGTGTGTTCTGCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146942215 Original CRISPR CTGCGTCCAGGCTGTCTTCC GGG (reversed) Intergenic