ID: 1146943103

View in Genome Browser
Species Human (GRCh38)
Location 17:36857421-36857443
Sequence CTGTAAGAATAGATGGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146943103_1146943107 15 Left 1146943103 17:36857421-36857443 CCCATCTCCATCTATTCTTACAG No data
Right 1146943107 17:36857459-36857481 ACCTTTCACCCATGAACCTTGGG No data
1146943103_1146943106 14 Left 1146943103 17:36857421-36857443 CCCATCTCCATCTATTCTTACAG No data
Right 1146943106 17:36857458-36857480 AACCTTTCACCCATGAACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146943103 Original CRISPR CTGTAAGAATAGATGGAGAT GGG (reversed) Intergenic
No off target data available for this crispr