ID: 1146943103 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:36857421-36857443 |
| Sequence | CTGTAAGAATAGATGGAGAT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1146943103_1146943107 | 15 | Left | 1146943103 | 17:36857421-36857443 | CCCATCTCCATCTATTCTTACAG | No data | ||
| Right | 1146943107 | 17:36857459-36857481 | ACCTTTCACCCATGAACCTTGGG | No data | ||||
| 1146943103_1146943106 | 14 | Left | 1146943103 | 17:36857421-36857443 | CCCATCTCCATCTATTCTTACAG | No data | ||
| Right | 1146943106 | 17:36857458-36857480 | AACCTTTCACCCATGAACCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1146943103 | Original CRISPR | CTGTAAGAATAGATGGAGAT GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||