ID: 1146943328

View in Genome Browser
Species Human (GRCh38)
Location 17:36858753-36858775
Sequence TGAAGCCAGCTGGCCAAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146943320_1146943328 26 Left 1146943320 17:36858704-36858726 CCTGTCTCCTGGGGAGGAGGTCA No data
Right 1146943328 17:36858753-36858775 TGAAGCCAGCTGGCCAAGTTTGG No data
1146943324_1146943328 -7 Left 1146943324 17:36858737-36858759 CCTGAGAAGAACACCCTGAAGCC No data
Right 1146943328 17:36858753-36858775 TGAAGCCAGCTGGCCAAGTTTGG No data
1146943322_1146943328 19 Left 1146943322 17:36858711-36858733 CCTGGGGAGGAGGTCAGTGGCAT No data
Right 1146943328 17:36858753-36858775 TGAAGCCAGCTGGCCAAGTTTGG No data
1146943319_1146943328 27 Left 1146943319 17:36858703-36858725 CCCTGTCTCCTGGGGAGGAGGTC No data
Right 1146943328 17:36858753-36858775 TGAAGCCAGCTGGCCAAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146943328 Original CRISPR TGAAGCCAGCTGGCCAAGTT TGG Intergenic
No off target data available for this crispr