ID: 1146948486

View in Genome Browser
Species Human (GRCh38)
Location 17:36890153-36890175
Sequence CTCTGATAAGGCCTTGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146948486_1146948491 16 Left 1146948486 17:36890153-36890175 CCCAGAGCAAGGCCTTATCAGAG No data
Right 1146948491 17:36890192-36890214 TATCTGACTCCCCATCAAATAGG No data
1146948486_1146948493 24 Left 1146948486 17:36890153-36890175 CCCAGAGCAAGGCCTTATCAGAG No data
Right 1146948493 17:36890200-36890222 TCCCCATCAAATAGGAAAACGGG No data
1146948486_1146948492 23 Left 1146948486 17:36890153-36890175 CCCAGAGCAAGGCCTTATCAGAG No data
Right 1146948492 17:36890199-36890221 CTCCCCATCAAATAGGAAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146948486 Original CRISPR CTCTGATAAGGCCTTGCTCT GGG (reversed) Intergenic