ID: 1146948487

View in Genome Browser
Species Human (GRCh38)
Location 17:36890154-36890176
Sequence GCTCTGATAAGGCCTTGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146948487_1146948493 23 Left 1146948487 17:36890154-36890176 CCAGAGCAAGGCCTTATCAGAGC No data
Right 1146948493 17:36890200-36890222 TCCCCATCAAATAGGAAAACGGG No data
1146948487_1146948492 22 Left 1146948487 17:36890154-36890176 CCAGAGCAAGGCCTTATCAGAGC No data
Right 1146948492 17:36890199-36890221 CTCCCCATCAAATAGGAAAACGG No data
1146948487_1146948497 30 Left 1146948487 17:36890154-36890176 CCAGAGCAAGGCCTTATCAGAGC No data
Right 1146948497 17:36890207-36890229 CAAATAGGAAAACGGGCCTCAGG No data
1146948487_1146948491 15 Left 1146948487 17:36890154-36890176 CCAGAGCAAGGCCTTATCAGAGC No data
Right 1146948491 17:36890192-36890214 TATCTGACTCCCCATCAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146948487 Original CRISPR GCTCTGATAAGGCCTTGCTC TGG (reversed) Intergenic