ID: 1146948488

View in Genome Browser
Species Human (GRCh38)
Location 17:36890165-36890187
Sequence GCAGGCAGCTTGCTCTGATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146948488_1146948492 11 Left 1146948488 17:36890165-36890187 CCTTATCAGAGCAAGCTGCCTGC No data
Right 1146948492 17:36890199-36890221 CTCCCCATCAAATAGGAAAACGG No data
1146948488_1146948491 4 Left 1146948488 17:36890165-36890187 CCTTATCAGAGCAAGCTGCCTGC No data
Right 1146948491 17:36890192-36890214 TATCTGACTCCCCATCAAATAGG No data
1146948488_1146948493 12 Left 1146948488 17:36890165-36890187 CCTTATCAGAGCAAGCTGCCTGC No data
Right 1146948493 17:36890200-36890222 TCCCCATCAAATAGGAAAACGGG No data
1146948488_1146948497 19 Left 1146948488 17:36890165-36890187 CCTTATCAGAGCAAGCTGCCTGC No data
Right 1146948497 17:36890207-36890229 CAAATAGGAAAACGGGCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146948488 Original CRISPR GCAGGCAGCTTGCTCTGATA AGG (reversed) Intergenic