ID: 1146948491

View in Genome Browser
Species Human (GRCh38)
Location 17:36890192-36890214
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146948487_1146948491 15 Left 1146948487 17:36890154-36890176 CCAGAGCAAGGCCTTATCAGAGC No data
Right 1146948491 17:36890192-36890214 TATCTGACTCCCCATCAAATAGG No data
1146948486_1146948491 16 Left 1146948486 17:36890153-36890175 CCCAGAGCAAGGCCTTATCAGAG No data
Right 1146948491 17:36890192-36890214 TATCTGACTCCCCATCAAATAGG No data
1146948488_1146948491 4 Left 1146948488 17:36890165-36890187 CCTTATCAGAGCAAGCTGCCTGC No data
Right 1146948491 17:36890192-36890214 TATCTGACTCCCCATCAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146948491 Original CRISPR TATCTGACTCCCCATCAAAT AGG Intergenic
No off target data available for this crispr