ID: 1146948492

View in Genome Browser
Species Human (GRCh38)
Location 17:36890199-36890221
Sequence CTCCCCATCAAATAGGAAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146948489_1146948492 -7 Left 1146948489 17:36890183-36890205 CCTGCCATTTATCTGACTCCCCA No data
Right 1146948492 17:36890199-36890221 CTCCCCATCAAATAGGAAAACGG No data
1146948488_1146948492 11 Left 1146948488 17:36890165-36890187 CCTTATCAGAGCAAGCTGCCTGC No data
Right 1146948492 17:36890199-36890221 CTCCCCATCAAATAGGAAAACGG No data
1146948487_1146948492 22 Left 1146948487 17:36890154-36890176 CCAGAGCAAGGCCTTATCAGAGC No data
Right 1146948492 17:36890199-36890221 CTCCCCATCAAATAGGAAAACGG No data
1146948486_1146948492 23 Left 1146948486 17:36890153-36890175 CCCAGAGCAAGGCCTTATCAGAG No data
Right 1146948492 17:36890199-36890221 CTCCCCATCAAATAGGAAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146948492 Original CRISPR CTCCCCATCAAATAGGAAAA CGG Intergenic