ID: 1146948493

View in Genome Browser
Species Human (GRCh38)
Location 17:36890200-36890222
Sequence TCCCCATCAAATAGGAAAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146948486_1146948493 24 Left 1146948486 17:36890153-36890175 CCCAGAGCAAGGCCTTATCAGAG No data
Right 1146948493 17:36890200-36890222 TCCCCATCAAATAGGAAAACGGG No data
1146948487_1146948493 23 Left 1146948487 17:36890154-36890176 CCAGAGCAAGGCCTTATCAGAGC No data
Right 1146948493 17:36890200-36890222 TCCCCATCAAATAGGAAAACGGG No data
1146948488_1146948493 12 Left 1146948488 17:36890165-36890187 CCTTATCAGAGCAAGCTGCCTGC No data
Right 1146948493 17:36890200-36890222 TCCCCATCAAATAGGAAAACGGG No data
1146948490_1146948493 -10 Left 1146948490 17:36890187-36890209 CCATTTATCTGACTCCCCATCAA No data
Right 1146948493 17:36890200-36890222 TCCCCATCAAATAGGAAAACGGG No data
1146948489_1146948493 -6 Left 1146948489 17:36890183-36890205 CCTGCCATTTATCTGACTCCCCA No data
Right 1146948493 17:36890200-36890222 TCCCCATCAAATAGGAAAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146948493 Original CRISPR TCCCCATCAAATAGGAAAAC GGG Intergenic