ID: 1146950207

View in Genome Browser
Species Human (GRCh38)
Location 17:36900280-36900302
Sequence CGGCAGAGGCAGATGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146950204_1146950207 -6 Left 1146950204 17:36900263-36900285 CCGGATGGCACAGGCTGCGGCAG No data
Right 1146950207 17:36900280-36900302 CGGCAGAGGCAGATGGAGCAAGG No data
1146950196_1146950207 21 Left 1146950196 17:36900236-36900258 CCCAGCCTGCTGGGCTGGGCTGG No data
Right 1146950207 17:36900280-36900302 CGGCAGAGGCAGATGGAGCAAGG No data
1146950199_1146950207 16 Left 1146950199 17:36900241-36900263 CCTGCTGGGCTGGGCTGGCAAAC No data
Right 1146950207 17:36900280-36900302 CGGCAGAGGCAGATGGAGCAAGG No data
1146950198_1146950207 20 Left 1146950198 17:36900237-36900259 CCAGCCTGCTGGGCTGGGCTGGC No data
Right 1146950207 17:36900280-36900302 CGGCAGAGGCAGATGGAGCAAGG No data
1146950193_1146950207 29 Left 1146950193 17:36900228-36900250 CCTGGGGTCCCAGCCTGCTGGGC No data
Right 1146950207 17:36900280-36900302 CGGCAGAGGCAGATGGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146950207 Original CRISPR CGGCAGAGGCAGATGGAGCA AGG Intergenic
No off target data available for this crispr