ID: 1146952589

View in Genome Browser
Species Human (GRCh38)
Location 17:36917035-36917057
Sequence CCTAGCACTGTACCTGGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146952589_1146952595 9 Left 1146952589 17:36917035-36917057 CCTGGGCCAGGTACAGTGCTAGG No data
Right 1146952595 17:36917067-36917089 TGCATGATTTCCATTTAAAGGGG No data
1146952589_1146952597 13 Left 1146952589 17:36917035-36917057 CCTGGGCCAGGTACAGTGCTAGG No data
Right 1146952597 17:36917071-36917093 TGATTTCCATTTAAAGGGGGTGG No data
1146952589_1146952594 8 Left 1146952589 17:36917035-36917057 CCTGGGCCAGGTACAGTGCTAGG No data
Right 1146952594 17:36917066-36917088 TTGCATGATTTCCATTTAAAGGG No data
1146952589_1146952596 10 Left 1146952589 17:36917035-36917057 CCTGGGCCAGGTACAGTGCTAGG No data
Right 1146952596 17:36917068-36917090 GCATGATTTCCATTTAAAGGGGG No data
1146952589_1146952593 7 Left 1146952589 17:36917035-36917057 CCTGGGCCAGGTACAGTGCTAGG No data
Right 1146952593 17:36917065-36917087 CTTGCATGATTTCCATTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146952589 Original CRISPR CCTAGCACTGTACCTGGCCC AGG (reversed) Intergenic
No off target data available for this crispr