ID: 1146952593

View in Genome Browser
Species Human (GRCh38)
Location 17:36917065-36917087
Sequence CTTGCATGATTTCCATTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146952589_1146952593 7 Left 1146952589 17:36917035-36917057 CCTGGGCCAGGTACAGTGCTAGG No data
Right 1146952593 17:36917065-36917087 CTTGCATGATTTCCATTTAAAGG No data
1146952588_1146952593 8 Left 1146952588 17:36917034-36917056 CCCTGGGCCAGGTACAGTGCTAG No data
Right 1146952593 17:36917065-36917087 CTTGCATGATTTCCATTTAAAGG No data
1146952587_1146952593 11 Left 1146952587 17:36917031-36917053 CCTCCCTGGGCCAGGTACAGTGC No data
Right 1146952593 17:36917065-36917087 CTTGCATGATTTCCATTTAAAGG No data
1146952591_1146952593 1 Left 1146952591 17:36917041-36917063 CCAGGTACAGTGCTAGGCCATTG No data
Right 1146952593 17:36917065-36917087 CTTGCATGATTTCCATTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146952593 Original CRISPR CTTGCATGATTTCCATTTAA AGG Intergenic
No off target data available for this crispr