ID: 1146952597

View in Genome Browser
Species Human (GRCh38)
Location 17:36917071-36917093
Sequence TGATTTCCATTTAAAGGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1146952588_1146952597 14 Left 1146952588 17:36917034-36917056 CCCTGGGCCAGGTACAGTGCTAG No data
Right 1146952597 17:36917071-36917093 TGATTTCCATTTAAAGGGGGTGG No data
1146952589_1146952597 13 Left 1146952589 17:36917035-36917057 CCTGGGCCAGGTACAGTGCTAGG No data
Right 1146952597 17:36917071-36917093 TGATTTCCATTTAAAGGGGGTGG No data
1146952592_1146952597 -10 Left 1146952592 17:36917058-36917080 CCATTGACTTGCATGATTTCCAT No data
Right 1146952597 17:36917071-36917093 TGATTTCCATTTAAAGGGGGTGG No data
1146952591_1146952597 7 Left 1146952591 17:36917041-36917063 CCAGGTACAGTGCTAGGCCATTG No data
Right 1146952597 17:36917071-36917093 TGATTTCCATTTAAAGGGGGTGG No data
1146952587_1146952597 17 Left 1146952587 17:36917031-36917053 CCTCCCTGGGCCAGGTACAGTGC No data
Right 1146952597 17:36917071-36917093 TGATTTCCATTTAAAGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1146952597 Original CRISPR TGATTTCCATTTAAAGGGGG TGG Intergenic
No off target data available for this crispr